| Sequence ID | >W11180061 |
| Genome ID | AGHH01000347 |
| Phylum/Class | Bacillota |
| Species | Streptococcus sobrinus TCI-381 [AGHH] |
| Start position on genome | 149 |
| End posion on genome | 222 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
tacatagtga |
| tRNA gene sequence |
GCACCCTTGGCTCAACTGGATAGAGTACCTGACTACGAATCAGGCGGTTAGAGGTTCGAA |
| Downstream region at tRNA end position |
aaaacgggaa |
| Secondary structure (Cloverleaf model) | >W11180061 Arg ACG
a Atat aaaacgggaa
G - C
C - G
A - T
C - G
C - G
C - G
T - A T A
T T C T C C A
C A A G | | | | | G
T C T C G A G A G G C
G | | | + T T
G G A G T
A T A A CGGTT
C - G
C - G
T - A
G - C
A - T
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |