Sequence ID | >W11181093 |
Genome ID | AGIS01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Hyphomicrobium denitrificans 1NES1 [AGIS] |
Start position on genome | 103941 |
End posion on genome | 104016 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gcgccgcggc |
tRNA gene sequence |
GGGTGATTAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCGAAGGTTCGAGT |
Downstream region at tRNA end position |
aaatcaaggg |
Secondary structure (Cloverleaf model) | >W11181093 Lys CTT c ACCA aaatcaaggg G - C G - C G - C T - A G - C A - T T - A T G T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |