| Sequence ID | >W11181563 |
| Genome ID | AGKG01000014 |
| Phylum/Class | Bacillota |
| Species | Streptococcus mutans TCI-109 [AGKG] |
| Start position on genome | 189 |
| End posion on genome | 264 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
gcataggctT |
| tRNA gene sequence |
GGGCGCGTAGCTCAGCTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG |
| Downstream region at tRNA end position |
agtatattgg |
| Secondary structure (Cloverleaf model) | >W11181563 Ile GAT
T ATat agtatattgg
G - C
G - C
G - C
C - G
G + T
C - G
G - C T G
T T C A C C A
C G A A + | | | | G
T C T C G G G T G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
G - C
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |