Sequence ID | >W11184367 |
Genome ID | BABS01000015 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Acetobacter tropicalis NBRC 101654 [BABS] |
Start position on genome | 10849 |
End posion on genome | 10773 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tgcaggtcat |
tRNA gene sequence |
CGGAGTGTAGCTCAGCCTGGTAGAGCACTGTGTTCGGGACGCAGGGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
gacttttccc |
Secondary structure (Cloverleaf model) | >W11184367 Pro CGG t ACCA gacttttccc C - G G - C G - C A - T G - C T - A G - C T A T T C T C C A C G A A + | | | | G C C T C G G G A G G C T | | | | T T G G A G C G T A A GGGCC C - G T - A G - C T + G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |