Sequence ID | >W11187558 |
Genome ID | CAFB01000034 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Candidatus Glomeribacter gigasporarum gigasporarum BEG34 [CAFB] |
Start position on genome | 69104 |
End posion on genome | 69179 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttcaaagctt |
tRNA gene sequence |
GCCGGCTTAGCTCATCAGGTAGAGCGGATGATTTGTAATCATCAGGTGGCGGGTTCAAGT |
Downstream region at tRNA end position |
ttggtatcgg |
Secondary structure (Cloverleaf model) | >W11187558 Thr TGT t ACCA ttggtatcgg G - C C - G C - G G - C G - C C - G T - A T G T C G T C C A C T A A | | + | | A A C T C G G C G G G C G | | | | T T G G A G C T A G AGGTG G - C A - T T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |