Sequence ID | >C121000342 |
Genome ID | AP012044 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Oscillibacter valericigenes Sjm18-20 [AP012044] |
Start position on genome | 227284 |
End posion on genome | 227209 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gtaatgatat |
tRNA gene sequence |
CGCGGGGTAGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGGAGGTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
gaaaaagtct |
Secondary structure (Cloverleaf model) | >C121000342 Met CAT t ACCA gaaaaagtct C A G - C C - G G - C G - C G - C G - C T G T C G T C C A T G A A | + | | | G T C G A G G T A G G C G | | | | T T G G C T C T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |