Sequence ID | >C121014907 |
Genome ID | CP003652 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium pseudotuberculosis Cp162 [CP003652] |
Start position on genome | 232437 |
End posion on genome | 232512 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cgttaagcca |
tRNA gene sequence |
GCCGCCTTAGCTCAGTCGGTAGAGCGCTTCACTCGTAATGAAAAGGTCGCGAGTTCGATT |
Downstream region at tRNA end position |
caaaatccca |
Secondary structure (Cloverleaf model) | >C121014907 Thr CGT a TCCA caaaatccca G - C C - G C - G G - C C - G C - G T - A T T T C G C T C A T G A A | | | | | G C C T C G G C G A G C G | | | | T T G G A G C T A G AGGTC C A T - A T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |