Sequence ID | >C121008322 |
Genome ID | CP003208 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium diphtheriae INCA 402 [CP003208] |
Start position on genome | 1050240 |
End posion on genome | 1050315 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tgtcgaacat |
tRNA gene sequence |
GCCCCGTTCGTCTAGCGGCCTAGGACGTCGGCCTCTCACGCCGGTAACACGGGTTCAAAT |
Downstream region at tRNA end position |
ataaagcagc |
Secondary structure (Cloverleaf model) | >C121008322 Glu CTC t ACAA ataaagcagc G + T C - G C - G C - G C - G G - C T - A T A T T G C C C A C G A C | | | | | A G T C T G A C G G G C G + | | | T T C G G A C C T A G TAAC T + G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |