Sequence ID | >C121002967 |
Genome ID | CP002734 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Arachnia propionica F0230a [CP002734] |
Start position on genome | 1083946 |
End posion on genome | 1083873 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ccggtcccgc |
tRNA gene sequence |
GCACCACTAGCTCAACTGGCAGAGCAGCTGACTCTTAATCAGCGGGTTCAGGGTTCGAGT |
Downstream region at tRNA end position |
cgcaagggcc |
Secondary structure (Cloverleaf model) | >C121002967 Lys CTT c ACtg cgcaagggcc G + T C - G A - T C - G C - G A - T C - G T G T G T C C C A C A A A | | | | | G T C T C G C A G G G C G | | | | T T G G A G C C A A GGGTT G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |