Sequence ID | >C121015987 |
Genome ID | FN563149 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Prescottella equi 103S [FN563149] |
Start position on genome | 3259786 |
End posion on genome | 3259861 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
agcagagcta |
tRNA gene sequence |
GCGCCTATAGCTCAGTTGGTAGAGCAAGTGACTCTTAATCACTGGGTCCGGGGTTCGAGT |
Downstream region at tRNA end position |
agaaggcccc |
Secondary structure (Cloverleaf model) | >C121015987 Lys CTT a ACCG agaaggcccc G - C C - G G - C C - G C - G T + G A - T T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T A A GGGTC A - T G - C T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |