Sequence ID | >C121002953 |
Genome ID | CP002734 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Arachnia propionica F0230a [CP002734] |
Start position on genome | 2745291 |
End posion on genome | 2745215 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gccacccacc |
tRNA gene sequence |
GGCCAGGTAGCTCAGTTGGTAGTAGCGTTCGCCTGAAAAGTGAAAGGTCGCCGGTTCGAC |
Downstream region at tRNA end position |
gatgtgaatc |
Secondary structure (Cloverleaf model) | >C121002953 Phe GAA c ACCA gatgtgaatc G - C G - C C - G C - G A - T G - C G - C C C T C G G C C A T G A A | | | | | G T C T C G G C C G G C G | | | T T G T A G C T A G G AGGTC T - A T - A C - G G + T C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |