Sequence ID | >C121007017 |
Genome ID | CP003154 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Thiocystis violascens DSM 198 [CP003154] |
Start position on genome | 2088392 |
End posion on genome | 2088316 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
atgaacgcct |
tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGCTGGTTCAAC |
Downstream region at tRNA end position |
attatggggc |
Secondary structure (Cloverleaf model) | >C121007017 Ile GAT t ACCA attatggggc G - C G - C G - C T - A C - G T - A G - C T C T C G A C C A T G A A | | | | | A T C T C G G C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |