Sequence ID | >C121006976 |
Genome ID | CP003153 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Azospira oryzae PS [CP003153] |
Start position on genome | 374021 |
End posion on genome | 373948 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aaaatcgaac |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCTGAAGCCTTCCAAGCTTAAGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
ctccgcacgg |
Secondary structure (Cloverleaf model) | >C121006976 Gly TCC c TCCA ctccgcacgg G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A T AGAC G A A - T A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |