Sequence ID | >C121016225 |
Genome ID | FO203431 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Modestobacter marinus BC501 [FO203431] |
Start position on genome | 1683866 |
End posion on genome | 1683793 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gcgtccctcc |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCCCCAGCCTTCCAAGCTGGCCATGCCGGTTCGATCCC |
Downstream region at tRNA end position |
cgcactgacc |
Secondary structure (Cloverleaf model) | >C121016225 Gly TCC c TCCA cgcactgacc G - C C - G G - C G - C G - C T - A G - C C T T T G G C C A A A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A C CCAT C - G C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |