Sequence ID | >WENV055577 |
Genome ID | AACY023232014 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 815 |
End posion on genome | 740 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gttaacggag |
tRNA gene sequence |
GCCCCTTTAGCTCATCTGGTAGAGCAACTGATTTGTAATCAGTAGGTGGTCTGTTCGACT |
Downstream region at tRNA end position |
ctaacacaac |
Secondary structure (Cloverleaf model) | >WENV055577 Thr TGT g ACCA ctaacacaac G - C C - G C - G C - G C - G T - A T - A T C T C A G G C A C T A A | | | + | G T C T C G G T C T G C G | | | | T T G G A G C T A A AGGTG A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |