| Sequence ID | >C161000329 |
| Genome ID | AP014563 |
| Phylum/Class | Chloroflexota |
| Species | Dehalococcoides mccartyi IBARAKI [AP014563] |
| Start position on genome | 875783 |
| End posion on genome | 875859 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
tccgcttcta |
| tRNA gene sequence |
GGCCCCATGGTGTAGCGGTCTAACATGCCACCCTGTCACGGTGGAGATCGGGGGTTCGAA |
| Downstream region at tRNA end position |
ttgagcttct |
| Secondary structure (Cloverleaf model) | >C161000329 Asp GTC
a GCCA ttgagcttct
G - C
G + T
C - G
C - G
C - G
C - G
A - T T A
T C C C C C A
C G A G | | | | | G
G T G T G G G G G G C
G | | | + T T
T A C A T
C T A G AGATC
C - G
C - G
A - T
C - G
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |