Sequence ID | >C161001893 |
Genome ID | AP014881 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Acetobacter pasteurianus NBRC 101655 [AP014881] |
Start position on genome | 2448667 |
End posion on genome | 2448742 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tcagcctctt |
tRNA gene sequence |
GTCCCGTTCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGCAACACGGGTTCGAAT |
Downstream region at tRNA end position |
cttttgctca |
Secondary structure (Cloverleaf model) | >C161001893 Glu TTC t GCCA cttttgctca G - C T - A C - G C - G C - G G - C T - A T A T T G C C C A A G A C | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C T A A CAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |