Sequence ID | >C161002001 |
Genome ID | AP014925 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Prevotella intermedia 17-2 [AP014925, AP014926] |
Start position on genome | 1716864 |
End posion on genome | 1716937 |
Amino Acid | Pseudo |
Anticodon | GCA |
Upstream region at tRNA start position |
aaattattat |
tRNA gene sequence |
GGTGCCTGGGCCGGTCGGTTAGGTAACGGTCTGCAAAACCGTGTAGAGCAGTTCGATTCT |
Downstream region at tRNA end position |
agcccgaaag |
Secondary structure (Cloverleaf model) | >C161002001 Pseudo GCA t TCAA agcccgaaag G - C G - C T - A G - C C - G C - G T - A T T G T C G T C A T G G | | | | | G C G C C G A G C A G C G | | + T T G A G G T T T A GTAG A - T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |