Sequence ID | >C161017264 |
Genome ID | CP007548 |
Search identical group | |
Phylum/Class | Spirochaetota |
Species | Treponema pallidum subsp. endemicum str. Bosnia A [CP007548] |
Start position on genome | 697254 |
End posion on genome | 697326 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgcggtgtgc |
tRNA gene sequence |
GCCGTTGTAGCTCAGTCGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGACAGTTCGATT |
Downstream region at tRNA end position |
ctgccgccct |
Secondary structure (Cloverleaf model) | >C161017264 Phe GAA c Aatg ctgccgccct G - C C - G C - G G - C T - A T + G G - C T T T C T G T C A T G A A | | | | | G C C T C G G A C A G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |