Sequence ID | >C161021180 |
Genome ID | CP009240 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Megasphaera elsdenii 14-14 [CP009240] |
Start position on genome | 252705 |
End posion on genome | 252631 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ctcgccccat |
tRNA gene sequence |
AGGGGTATAGCCAAGTGGTAAGGCACCGGACTTTGACTCCGCTATGCGCTGGTTCGAATC |
Downstream region at tRNA end position |
gccatgattc |
Secondary structure (Cloverleaf model) | >C161021180 Gln TTG t GCCA gccatgattc A - T G - C G - C G - C G - C T - A A - T T A T C G A C C A G A A | | | | | G T A C C G G C T G G C G | | | T T G A G G C T A A TATGC C C C - G G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |