Sequence ID | >C161024525 |
Genome ID | CP010278 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium psychrophilum 3 [CP010278] |
Start position on genome | 2687391 |
End posion on genome | 2687467 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aaaaaatatt |
tRNA gene sequence |
GGGGGATTAGCTCATTTGGCTAGAGCGCTTGCCTGGCAGGCAAGAGGTGGTCGGTTCGAA |
Downstream region at tRNA end position |
taaaaccaaa |
Secondary structure (Cloverleaf model) | >C161024525 Ala GGC t ACTA taaaaccaaa G - C G - C G + T G - C G + T A - T T - A T A T T A G C C A T T A A + | | | | G T C T C G G T C G G C G | | | | T T G G A G C C T A G AGGTG C - G T - A T - A G - C C - G C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |