| Sequence ID | >C161026436 |
| Genome ID | CP010476 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni CJ677CC521 [CP010476] |
| Start position on genome | 1121425 |
| End posion on genome | 1121350 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
taaacatcgt |
| tRNA gene sequence |
GGTTGGATAGCTCAGTCGGTAGAGCAGCAGACTGAAAATCTGCGTGTCGGCAGTTCGATT |
| Downstream region at tRNA end position |
ctttatcttt |
| Secondary structure (Cloverleaf model) | >C161026436 Phe GAA
t ACCA ctttatcttt
G - C
G - C
T - A
T - A
G + T
G - C
A - T T T
T C C G T C A
T G A A | | | | | G
C C T C G G G C A G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
C - G
A - T
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |