| Sequence ID | >C161026588 |
| Genome ID | CP010480 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni CJ677CC524 [CP010480] |
| Start position on genome | 1593632 |
| End posion on genome | 1593707 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
tccaccatat |
| tRNA gene sequence |
GGTTCCGTAGCTCAGCTGGTAGAGCACTACCTTGACATGGTAGTGGCCGTTGGTTCAAGT |
| Downstream region at tRNA end position |
tcacccttcc |
| Secondary structure (Cloverleaf model) | >C161026588 Val GAC
t ACCA tcacccttcc
G - C
G - C
T + G
T - A
C - G
C - G
G - C T G
T T A A C C A
C G A A + | | | | A
T C T C G G T T G G C
G | | | | T T
G G A G C
T A A TGGCC
C - G
T - A
A - T
C - G
C - G
T T
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |