| Sequence ID | >C161037462 |
| Genome ID | CP011806 |
| Phylum/Class | Acidobacteriota |
| Species | Acidobacteria bacterium Mor1 [CP011806] |
| Start position on genome | 1742321 |
| End posion on genome | 1742394 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
gcgacagtat |
| tRNA gene sequence |
TGGGGTGTCGTCCAATGGCAGGACATGCGGCTCTGGACCGTAGAATCGGGGTTCGAATCC |
| Downstream region at tRNA end position |
cccccgtacc |
| Secondary structure (Cloverleaf model) | >C161037462 Gln CTG
t GCCA cccccgtacc
T - A
G - C
G - C
G - C
G - C
T - A
G - C T A
T G T C C C A
A A C | + | | | G
T C C T G C G G G G C
G | | | | T T
G G G A C
C A A GAAT
T - A
G + T
C - G
G - C
G - C
C A
T G
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |