Sequence ID | >C161037953 |
Genome ID | CP011941 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Synechococcus sp. WH 8020 [CP011941] |
Start position on genome | 1550454 |
End posion on genome | 1550526 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tgagagctgg |
tRNA gene sequence |
GGGCGATTAGCTCAGAGGTAGAGCACTACCTTGACACGGTAGGGGTCACTGGTTCGATTC |
Downstream region at tRNA end position |
ccctttaggg |
Secondary structure (Cloverleaf model) | >C161037953 Val GAC g ACtt ccctttaggg G - C G - C G - C C - G G - C A - T T - A T T T T G A C C A G A A | | | | | G A C T C G A C T G G C G | | | | T T G G A G C T A A GGGTC C - G T - A A - T C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |