Sequence ID | >C161041913 |
Genome ID | CP012401 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Azospirillum thiophilum BV-S [CP012401, CP012402, CP012403, CP012404, CP012405, CP012406, CP012407, CP012408] |
Start position on genome | 594924 |
End posion on genome | 594850 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
acgccatagt |
tRNA gene sequence |
GGGCGGTTAGCTCAGCGGGAGAGCACTACGTTGACATCGTAGGGGTCACTGGTTCAATCC |
Downstream region at tRNA end position |
tcttgaaggc |
Secondary structure (Cloverleaf model) | >C161041913 Val GAC t ACCA tcttgaaggc G - C G - C G - C C - G G - C G - C T - A C T T T G A C C A G A A | | | | | A C C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |