Sequence ID | >C161042804 |
Genome ID | CP012533 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Psychrobacter sp. P11G5 [CP012533] |
Start position on genome | 2429994 |
End posion on genome | 2429904 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atgcacaaat |
tRNA gene sequence |
GGAGACGTGGCAGAGCGGTTGAATGCACCGGTCTTGAAAACCGACAAGGGTTCATAGCCC |
Downstream region at tRNA end position |
aattcaaaaa |
Secondary structure (Cloverleaf model) | >C161042804 Ser TGA t GCCA aattcaaaaa G - C G - C A - T G - C A - T C - G G - C T A T C T C T C A C G A G | | | | | G G G A C G G A G A G C G | | | T T T A T G C T G A A CAAGGGTTCATAGCCCTTC C A C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |