Sequence ID | >C161048024 |
Genome ID | CP012946 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Blastochloris viridis ATCC 19567 [CP012946] |
Start position on genome | 2408125 |
End posion on genome | 2408048 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tgtcgccctt |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCCGGTTAGCGCACCAGTCTGGGGGACTGGGGGTCCCGAGTTCAA |
Downstream region at tRNA end position |
ttaaattcaa |
Secondary structure (Cloverleaf model) | >C161048024 Pro GGG t ACCA ttaaattcaa C - G G - C G - C A - T G - C C - G G - C T A T G G C T C A C C G A A | | | | | A C C G C G C C G A G C G | | | | T T G G C G C T T A A GGGTC C - G C - G A - T G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |