Sequence ID | >C161048264 |
Genome ID | CP012958 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Aggregatibacter actinomycetemcomitans VT1169 [CP012958] |
Start position on genome | 1325911 |
End posion on genome | 1325822 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ctcaaacctc |
tRNA gene sequence |
GGAGGAATGGTCGAGCGGTTGAAGGCACCGGTCTTGAAAACCGGCGAGGGTTTACACCCT |
Downstream region at tRNA end position |
tattcataaa |
Secondary structure (Cloverleaf model) | >C161048264 Ser TGA c GCCA tattcataaa G - C G - C A - T G - C G - C A - T A - T T A T G A C C C A C G A G | | | | | G G G C T G C T G G G C G | + | T T T A G G C T G A A CGAGGGTTTACACCCTCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |