Sequence ID | >C161060794 |
Genome ID | CP013828 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Acetivibrio thermocellus AD2 [CP013828] |
Start position on genome | 3189003 |
End posion on genome | 3188928 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tattttatat |
tRNA gene sequence |
GCCCTCATAGCTCAGTAGGCAGAGCGCATCCATGGTAAGGATGAGGTCACCAGTTCGATT |
Downstream region at tRNA end position |
gtttagagtc |
Secondary structure (Cloverleaf model) | >C161060794 Thr GGT t TCCA gtttagagtc G - C C - G C - G C - G T + G C - G A - T T T T T G G T C A T G A A | | | | | G A C T C G A C C A G C G | | | | T T G G A G C C A G AGGTC C - G A - T T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |