Sequence ID | >C161062271 |
Genome ID | CP013932 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alteromonas sp. Mac1 [CP013932] |
Start position on genome | 1352636 |
End posion on genome | 1352563 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctagtattac |
tRNA gene sequence |
GGCGGAATGGCAGAATGGCTATGCAGCGGATTGCAAATCCGTGGATCTCGGTTCGACTCC |
Downstream region at tRNA end position |
taatgcttta |
Secondary structure (Cloverleaf model) | >C161062271 Cys GCA c TCCA taatgcttta G - C G - C C - G G - C G - C A - T A - T T C T G G G C C A A A G | + | | | G T G A C G C T C G G C G | | | T T G A T G C C T A GGAT G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |