Sequence ID | >C161066320 |
Genome ID | CP014067 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus gallinarum FDAARGOS_163 [CP014067] |
Start position on genome | 2147467 |
End posion on genome | 2147557 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cttttaggcT |
tRNA gene sequence |
GGAGAGTTGTCCGAGTGGCCGAAGGAGCATGATTGGAAATCATGTAGATGGCTATCGCTG |
Downstream region at tRNA end position |
taaacttagg |
Secondary structure (Cloverleaf model) | >C161066320 Ser GGA T GTtt taaacttagg G - C G - C A - T G - C A - T G - C T - A T A T T T C C C A T G A G | | | | | G G G C C T A A G G G C G | | | T T C A G G A C G A G TAGATGGCTATCGCTGTCTC C - G A - T T - A G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |