Sequence ID | >C161067220 |
Genome ID | CP014145 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Microterricola viridarii ERGS5:02 [CP014145] |
Start position on genome | 876017 |
End posion on genome | 876089 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aggtgggcat |
tRNA gene sequence |
TGGGGTATGGTGTAATTGGCAACACGGAGGTTTCTGGTACCTTTGTTCTTGGTTCGAGTC |
Downstream region at tRNA end position |
aaacagacat |
Secondary structure (Cloverleaf model) | >C161067220 Gln CTG t GCac aaacagacat T - A G - C G - C G - C G - C T - A A - T T G T G G A C C A T A A G | + | | | G T T G T G C T T G G C G | | | | T T G A C A C C A G TGTT G + T A - T G - C G - C T - A T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |