Sequence ID | >C161068254 |
Genome ID | CP014206 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Pseudodesulfovibrio indicus J2 [CP014206] |
Start position on genome | 2729964 |
End posion on genome | 2730040 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cacttcgcgt |
tRNA gene sequence |
CGGGATGTAGCGCAGTCTGGGAGCGCACTTGAATGGGGTTCAAGGGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
aacgatgaag |
Secondary structure (Cloverleaf model) | >C161068254 Pro GGG t ACCA aacgatgaag C - G G - C G - C G - C A - T T - A G - C T A T T C T C C A T G A A + | | | | A C C G C G G G A G G C T | | | | T T G G C G C G G A A GGGTC C - G T - A T - A G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |