Sequence ID | >C161068282 |
Genome ID | CP014206 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Pseudodesulfovibrio indicus J2 [CP014206] |
Start position on genome | 2110839 |
End posion on genome | 2110753 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcctgaacgt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTAGGTTCAGGGTCTAGTGGGAGTATTCCCGTG |
Downstream region at tRNA end position |
tgaaagaaca |
Secondary structure (Cloverleaf model) | >C161068282 Leu CAG t ACCA tgaaagaaca G - C C - G C - G G - C A - T A - T G - C T G T T C T T C A T A A G + | | | | G T G G T G G G A A G C G | | | T T G A C A C T A G G TGGGAGTATTCCCGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |