Sequence ID | >C161069259 |
Genome ID | CP014239 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Selenomonas sp. oral taxon 136 F0591 [CP014239] |
Start position on genome | 1790553 |
End posion on genome | 1790627 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tgacatatgt |
tRNA gene sequence |
GGCGCCTTCGTCAAGTGGTTAAGACACCGCCCTCTCACGGCGGGTTCATGGGTTCGAATC |
Downstream region at tRNA end position |
aattcggcgc |
Secondary structure (Cloverleaf model) | >C161069259 Glu CTC t ACCA aattcggcgc G - C G + T C - G G - C C - G C - G T - A T A T T A C C C A T G A C | | | | | G G A C T G A T G G G C G | | | T T T A G A C T A A GTTC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |