Sequence ID | >C161073342 |
Genome ID | CP014525 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Haematospirillum jordaniae H5569 [CP014525] |
Start position on genome | 664617 |
End posion on genome | 664691 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tgtccgccga |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGAGGGTTCGAATC |
Downstream region at tRNA end position |
ttttcaagaa |
Secondary structure (Cloverleaf model) | >C161073342 Gly GCC a TCCA ttttcaagaa G - C C - G G - C G - C G - C C - G G - C T A T T T C C C A G A A + | | | | G G C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |