Sequence ID | >C161077336 |
Genome ID | CP014780 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactiplantibacillus plantarum JBE245 [CP014780] |
Start position on genome | 1186027 |
End posion on genome | 1186100 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tgccatgatg |
tRNA gene sequence |
GCGGTAGTGGCGAAGTGGTTAACGCACCGGATTGTGGCTCCGGCACGCGTGGGTTCGATT |
Downstream region at tRNA end position |
tgattgggtt |
Secondary structure (Cloverleaf model) | >C161077336 His GTG g CCtt tgattgggtt G - C C - G G - C G - C T - A A - T G - C T T T C A C C C A T G A G | | | | | G G A G C G G T G G G C G | | | T T T A C G C T A A CACGC C - G C - G G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |