Sequence ID | >C161079249 |
Genome ID | CP014945 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Psychrobacter alimentarius PAMC 27889 [CP014945] |
Start position on genome | 93650 |
End posion on genome | 93734 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taagaaagat |
tRNA gene sequence |
GCGATTGTGGTGGAATTGGTAGACACGCCATCTTGAGGGGGTGGTGGCGCAAGCTGTGGG |
Downstream region at tRNA end position |
agtttttatt |
Secondary structure (Cloverleaf model) | >C161079249 Leu GAG t ACCA agtttttatt G - C C - G G - C A - T T - A T - A G - C T G T C C C C C A T A A G | | | | | A T G G T G G G G G G C G | | | T T G A C A C T A G G TGGCGCAAGCTGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |