Sequence ID | >C161083526 |
Genome ID | CP015125 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Dokdonia donghaensis DSW-1 [CP015125] |
Start position on genome | 2977579 |
End posion on genome | 2977653 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taagtaagat |
tRNA gene sequence |
GGCGAGGTAGCTCAGTTGGTTAGAGCGTCGGATTCATAACCCGGAGGTCGGGGGATCGTG |
Downstream region at tRNA end position |
gataattaag |
Secondary structure (Cloverleaf model) | >C161083526 Met CAT t ACtt gataattaag G + T G - C C - G G - C A - T G - C G + T C G T C C C C C T T G A A | | | | | G T C T C G G G G G G C G | | | | A T G G A G C T T A G AGGTC T + G C - G G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |