Sequence ID | >C161089120 |
Genome ID | CP015511 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Brevundimonas sp. GW460-12-10-14-LB2 [CP015511] |
Start position on genome | 2459583 |
End posion on genome | 2459508 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
cgctggaaac |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGTAGAGCGCGTCGTTCGCAATGACGAGGTCAGGGGTTCGACT |
Downstream region at tRNA end position |
atccctgtta |
Secondary structure (Cloverleaf model) | >C161089120 Ala CGC c ACCA atccctgtta G - C G - C G + T G - C C - G C - G G - C T C T T C C C C A T G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C T A G AGGTC C - G G - C T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |