Sequence ID | >C161092417 |
Genome ID | CP015963 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Altererythrobacter ishigakiensis NBRC 107699 [CP015963] |
Start position on genome | 2092450 |
End posion on genome | 2092526 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gctgcctgat |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCTGGCCGCTCATAACGGCTAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
gtggcaaggg |
Secondary structure (Cloverleaf model) | >C161092417 Met CAT t ACCA gtggcaaggg G - C G - C G - C C - G C - G T + G G - C T G T C G T C C A T G A A | | + | | G T C T C G G C G G G C G | | | | T T G G A G C T T A T AGGTC G + T G - C C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |