Sequence ID | >C161092721 |
Genome ID | CP015986 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingobium sp. EP60837 [CP015986, CP015987] |
Start position on genome | 2594202 |
End posion on genome | 2594286 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
agccatgcac |
tRNA gene sequence |
GCGGGCGTGGTGAAACTGGTAGACGCGCCGGACTCAAAATCCGGTTCCGAAAGGAGTGTC |
Downstream region at tRNA end position |
tctcctccga |
Secondary structure (Cloverleaf model) | >C161092721 Leu CAA c ACCA tctcctccga G - C C - G G - C G - C G - C C - G G - C T T T C A G C C A C A A G | | | | | G T A G T G G T C G G C G | + | T T G A C G C T A G G TTCCGAAAGGAGT C - G C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |