Sequence ID | >C161093689 |
Genome ID | CP016033 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Erythrobacter neustonensis DSM 9434 [CP016033] |
Start position on genome | 2226663 |
End posion on genome | 2226588 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttgcgcaac |
tRNA gene sequence |
GGGCCTGTAGCTCAGCGGTTAGAGCTGGCCGCTCATAACGGCTAGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
gaaggcgggc |
Secondary structure (Cloverleaf model) | >C161093689 Met CAT c ACCG gaaggcgggc G - C G - C G - C C - G C - G T + G G - C T A T C G T C C A C G A A | | + | | G G C T C G G C G G G C G | | | | T T T G A G C T A T AGGTC G + T G - C C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |