Sequence ID | >C161096333 |
Genome ID | CP016345 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio natriegens NBRC 15636 = ATCC 14048 = DSM 759 [CP016345, CP016346] |
Start position on genome | 971126 |
End posion on genome | 971042 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaaataccct |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGAGCAGACTGTAAATCTGCCGGCACTGCCTTCGAT |
Downstream region at tRNA end position |
tattttttct |
Secondary structure (Cloverleaf model) | >C161096333 Tyr GTA t ACCA tattttttct G - C G - C A - T G - C G - C G - C G - C T A T C T G C C A T G A T | | + | | G G G C C C G A T G G C G | | | T T C A G G G C A A A CGGCACTGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |