Sequence ID | >C161097413 |
Genome ID | CP016483 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Picosynechococcus sp. PCC 8807 [CP016483] |
Start position on genome | 1261098 |
End posion on genome | 1261025 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aacaaatttg |
tRNA gene sequence |
CCAGGGTTGGCCGAGCGGTTTAGGCAACGAACTCATAATTCGTCCCAGGCAGGTTCAACT |
Downstream region at tRNA end position |
tcagataaat |
Secondary structure (Cloverleaf model) | >C161097413 Met CAT g ACtt tcagataaat C - G C - G A - T G - C G - C G - C T - A T C T C G T C C A C G A G | | | | | A G G C C G G C A G G C G | | | T T T A G G C T T A CCCAG A - T C - G G - C A - T A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |