Sequence ID | >C161102271 |
Genome ID | CP016674 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Neisseria meningitidis M22160 [CP016674] |
Start position on genome | 844994 |
End posion on genome | 845069 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cagccctttt |
tRNA gene sequence |
TGGGGAGTCGTCAAGCGGTTAAGACACTGGATTTTGATTCCAGCATGCGAAGGTTCGAAT |
Downstream region at tRNA end position |
aataaaagcg |
Secondary structure (Cloverleaf model) | >C161102271 Gln TTG t GCCA aataaaagcg T - A G - C G - C G - C G - C A - T G - C T A T C T T C C A C G A C | | | | | G G A C T G G A A G G C G | | | T T T A G A C T A A CATGC C - G T - A G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |