Sequence ID | >C161103369 |
Genome ID | FP929042 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Agathobacter rectalis DSM 17629 [FP929042] |
Start position on genome | 2010682 |
End posion on genome | 2010756 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ctgaatataT |
tRNA gene sequence |
GGGATATTAGCTCAGGTGGTAGAGCACTTGACTTTTAATCAAGTTGTCCGGGGTTCGAAT |
Downstream region at tRNA end position |
aaaatgcctc |
Secondary structure (Cloverleaf model) | >C161103369 Lys TTT T ATta aaaatgcctc G - C G + T G - C A - T T + G A - T T - A T A T G C C C C A G G A A | | | | | G T C T C G C G G G G C G | | | | T T G G A G C T A A TTGTC C - G T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |