Sequence ID | >C161103702 |
Genome ID | FP929049 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Roseburia intestinalis M50/1 [FP929049] |
Start position on genome | 767957 |
End posion on genome | 768032 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tgtgataaaT |
tRNA gene sequence |
GTGTTCGTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ccttatttta |
Secondary structure (Cloverleaf model) | >C161103702 Arg TCT T ATtt ccttatttta G - C T - A G - C T + G T - A C - G G - C T A T T T C C C A C G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |