Sequence ID | >C161104242 |
Genome ID | FP929062 |
Search identical group | |
Phylum/Class | Bacillota |
Species | butyrate-producing bacterium SS3/4 [FP929062] |
Start position on genome | 2016655 |
End posion on genome | 2016580 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
taaaatattT |
tRNA gene sequence |
GGCCCGGTGGCTCAGCTGGTTAGAGCGCCGCCCTGTCACGGCGGAGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
ccttagaaat |
Secondary structure (Cloverleaf model) | >C161104242 Asp GTC T GTtt ccttagaaat G - C G + T C - G C - G C - G G - C G - C T A T T A C C C A C G A G + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |